Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 27755385 27765695 enh4322

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 27764266 rs556175514 AAGACGGGGTTACACCATGTTGGCC A 4816891

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results