Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 29114065 29118215 enh32162

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 29114600 rs550185913 GATGTGATTATTTATAGTCA G 4822682

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results