| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 29412565 | 29416715 | enh4350 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 29414711 | rs200002125 | TAGGCAGTTCAGGGCAGGTACAGCTGCTTG | T | 4824040 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr17 | 29421376 | 29421397 | - | hsa-miR-4733-3p | MIMAT0019858 | 29422507 | 0.86673 | 0.0 | 7783 | 687 |