Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 29412565 29416715 enh4350

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 29414711 rs200002125 TAGGCAGTTCAGGGCAGGTACAGCTGCTTG T 4824040

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 29421376 29421397 - hsa-miR-4733-3p MIMAT0019858 29422507 0.86673 0.0 7783 687