Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30462005 30468267 enh52462

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30464661 rs145652263 CTAATATATATATATATATATATATATATATATAT C 4829800

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 30469473 30580393 + RHOT1 ENSG00000126858.12 30469473 0.69 0.99 4808 15631


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results