EnhancerDB
  1. Home
  2. TFBS
  3. FOXP1[chr17:30464650-30464665]
Chromosome characteristics of FOXP1[chr17:30464650-30464665]
Back to top
Enhancers possibly regulated by FOXP1[chr17:30464650-30464665]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30462005 30468267 enh52462
Bone Marrow (K562) Cervix (HeLa-S3) Prostate (RWPE1) Large Intestine Lung Pancreas (Panc1)
SNP sites on FOXP1[chr17:30464650-30464665]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30464661 rs145652263 CTAATATATATATATATATATATATATATATATAT C 4829800
Genes possibly regulated by FOXP1[chr17:30464650-30464665]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 30469473 30580393 + RHOT1 ENSG00000126858.12 30469473 0.69 0.99 4808 15631
Expression level of Genes
Back to top
miRNAs possibly regulated by FOXP1[chr17:30464650-30464665]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results