Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr17 | 30462005 | 30468267 | enh52462 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr17 | 30464661 | rs145652263 | CTAATATATATATATATATATATATATATATATAT | C | 4829800 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr17 | 30469473 | 30580393 | + | RHOT1 | ENSG00000126858.12 | 30469473 | 0.69 | 0.99 | 4808 | 15631 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|