EnhancerDB
  1. Home
  2. TFBS
  3. FOXC1[chr17:32828796-32828807]
Chromosome characteristics of FOXC1[chr17:32828796-32828807]
Back to top
Enhancers possibly regulated by FOXC1[chr17:32828796-32828807]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 32824725 32828875 enh95513
Ovary
SNP sites on FOXC1[chr17:32828796-32828807]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 32828802 rs145252753 AAACATAGAGCATAAGGAAAC A 4841180
chr17 32828802 rs370048685 AAACATAGAGCATAAGGAAAC A 4841181
chr17 32828807 rs534257070 T G 4841182
Genes possibly regulated by FOXC1[chr17:32828796-32828807]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXC1[chr17:32828796-32828807]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results