Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 32824725 32828875 enh95513

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 32828802 rs145252753 AAACATAGAGCATAAGGAAAC A 4841180
chr17 32828802 rs370048685 AAACATAGAGCATAAGGAAAC A 4841181

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results