Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 32937892 32945435 enh75895

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 32942158 rs149672153 TGGGTTTCCCCAGGAGCAGGACTAGGAGGCCA T 4841447
chr17 32942158 rs67718010 TGGGTTTCCCCAGGAGCAGGACTAGGAGGCCA T 4841448

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results