Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr17 | 32937892 | 32945435 | enh75895 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr17 | 32942158 | rs149672153 | TGGGTTTCCCCAGGAGCAGGACTAGGAGGCCA | T | 4841447 | |
chr17 | 32942158 | rs67718010 | TGGGTTTCCCCAGGAGCAGGACTAGGAGGCCA | T | 4841448 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|