Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 36131925 36136835 enh104324

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 36134339 rs372650004 AACAATGCTGAGGACATTGTTCTAAG A 4854428
chr17 36134339 rs562848476 AACAATGCTGAGGACATTGTTCTAAG A 4854429

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results