Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 42061665 42066236 enh44431

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 42063768 rs567298150 TCACCCCAAGACTGGGTCATGTGGCTTCCTGTG T 4887395

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results