Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 43430645 43435295 enh17188

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 43434186 rs565463888 TCCATCCACCCATCCGTCTACCCAC T 4895550

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results