Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 45180670 45184906 enh44438

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 45183802 rs541061621 T TGGTGGCGGGATGCTTCCAAGAC 4902853
chr17 45183802 rs568575078 T C 4902854

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results