Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47433525 47438360 enh48040

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47437241 rs138667851 TTATGGAGCAGGTACACCGC T 4915374
chr17 47437241 rs373947155 TTATGGAGCAGGTACACCGC T 4915375

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 47366568 47439835 - ZNF652 ENSG00000198740.4 47439835 0.69 1.0 2588 16012


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results