Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 49104529 49108791 enh4465

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 49104851 rs147735007 C CAACAGTACACTCATAAGAT 4927573

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results