Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 55773485 55778735 enh52536

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 55774511 rs140204329 A ACACACATACACACACACACT 4952540

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results