Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 60560431 60564595 enh89875

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 60562853 rs571274662 CTAATTTTCTTGCATAGTGCAAATTTT C 4973026

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results