Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 64386605 64390755 enh112519

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 64389839 rs560536921 G A,T 4997045
chr17 64389840 rs572079894 TGTCTAGCCCAGGCCTGAGTGCAGCGC T 4997046

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results