-
Home
- TFBS
- SNAI2[chr17:66211062-66211071]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr17 |
66207631 |
66213258 |
enh4553 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr17
|
66211064
|
rs144291247
|
ACAGGTGTGTGACACCACGC
|
A
|
5011034
|
|
|
chr17
|
66211064
|
rs72339421
|
ACAGGTGTGTGACACCACGC
|
A
|
5011035
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |