Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 127657045 127661195 enh82725

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 127658240 rs375124137 ACTGAAAATACCAGGGAGATC A 7016377
chr3 127658252 rs58025263 A T 7016378

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results