Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 67339225 67346875 enh52561

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 67343165 rs140900011 AAGAGGAGAGCAGAGGAGAGGAGAGG A 5017802
chr17 67343165 rs370897540 AAGAGGAGAGCAGAGGAGAGGAGAGG A 5017803
chr17 67343168 rs1310682 A G 5017804

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results