Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 67395025 67403515 enh17341

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 67403225 rs113696290 GATGATATGCTGACACTTTTA G 5018233
chr17 67403225 rs368583124 GATGATATGCTGACACTTTTA G 5018234
chr17 67403226 rs80084695 A G 5018235

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results