Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73818705 73826415 enh17380

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73820601 rs140311266 A ATG 5059229
chr17 73820613 rs541904570 TTATGTATATGTATACATTTCCGTATG T 5059230

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results