Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73818705 73826415 enh17380

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73823683 rs537494557 G A 5059267
chr17 73823691 rs534693259 A AGGCCAGGAGGCAGATGGGCCAG 5059268

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results