Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74347925 74367200 enh4606

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74348298 rs143786754 GAAAATGGCTTTAAATATTA G 5062231
chr17 74348298 rs371992395 GAAAATGGCTTTAAATATTA G 5062232

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results