Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74605545 74611935 enh17388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74610450 rs539428585 G A,C 5065411
chr17 74610452 rs146396442 AAAAC A 5065412
chr17 74610452 rs200511532 AAAAC A 5065413
chr17 74610452 rs71158036 AAAAC A 5065414
chr17 74610456 rs576413596 C CAAAGCACCCACAATTCAAGATTTATTGCAAAGAGCA 5065415
chr17 74610464 rs566586551 G A 5065416

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results