EnhancerDB
  1. Home
  2. TFBS
  3. FOXC2[chr17:74610451-74610463]
Chromosome characteristics of FOXC2[chr17:74610451-74610463]
Back to top
Enhancers possibly regulated by FOXC2[chr17:74610451-74610463]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74605545 74611935 enh17388
Liver Placenta Cervix (HeLa-S3) Epithelial (MCF-7)
SNP sites on FOXC2[chr17:74610451-74610463]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74610452 rs146396442 AAAAC A 5065412
chr17 74610452 rs200511532 AAAAC A 5065413
chr17 74610452 rs71158036 AAAAC A 5065414
chr17 74610456 rs576413596 C CAAAGCACCCACAATTCAAGATTTATTGCAAAGAGCA 5065415
Genes possibly regulated by FOXC2[chr17:74610451-74610463]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXC2[chr17:74610451-74610463]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results