| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 75274374 | 75281280 | enh102575 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 75275782 | rs531538961 | TGGCAGTGTCATCATGGCTAGGCTGGG | T | 5072374 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr17 | 75276651 | 75496678 | + | SEPT9 | ENSG00000184640.13 | 75276651 | 0.88 | 1.0 | 858 | 16298 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|