Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75274374 75281280 enh102575

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75275782 rs531538961 TGGCAGTGTCATCATGGCTAGGCTGGG T 5072374

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 75276651 75496678 + SEPT9 ENSG00000184640.13 75276651 0.88 1.0 858 16298


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results