Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75762582 75770815 enh32365

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75767639 rs538678506 GGGGCCTCAAATGGAGTCAAGAGAT G 5079107

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results