EnhancerDB
  1. Home
  2. TFBS
  3. TP53[chr17:76889276-76889296]
Chromosome characteristics of TP53[chr17:76889276-76889296]
Back to top
Enhancers possibly regulated by TP53[chr17:76889276-76889296]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 76889200 76896795 enh17417
Muscle (Myoblast) Placenta Bone (Osteoblast) Heart
SNP sites on TP53[chr17:76889276-76889296]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 76889280 rs559347541 A G 5091072
chr17 76889282 rs140317012 GATGTGTGTGC G 5091073
chr17 76889282 rs369175867 GATGTGTGTGC G 5091074
chr17 76889282 rs542683740 GATGTGTGTGCATGT G 5091075
chr17 76889282 rs545107565 GAT G 5091076
chr17 76889282 rs565887281 GATGTGTGTGC G 5091077
chr17 76889294 rs569677381 T TGTGTGTGCAGGGGTGTATAGAA 5091078
Genes possibly regulated by TP53[chr17:76889276-76889296]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TP53[chr17:76889276-76889296]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results