Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 76889200 76896795 enh17417

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 76893458 rs370419693 TGGGGTGGGCCTGTGAGAGAGTG T 5091173

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results