Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 128446744 128452495 enh65749

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 128451672 rs181722015 G A 7022132
chr3 128451679 rs542312158 GAAATTGAACTCTCCCCAAAAATGATGTGAGAATT G 7022133

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results