Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 78531547 78536855 enh32373

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 78535041 rs199787549 ATATATATATGTATATATATATG A 5102732
chr17 78535041 rs57371746 ATATATATATGTATATATATATG A 5102733

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results