Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79823005 79827155 enh4643

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79824896 rs575229839 GCCCCAGGAGGCCCTGCGTGGTTC G 5116918

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 79825597 79829282 - ARHGDIA ENSG00000141522.7 79829282 0.56 1.0 4375 16368


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results