Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80058005 80064135 enh4645

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80059834 rs555644736 CGTGTTCCCGGCCAGCGGGGGCCCT C 5118741
chr17 80059841 rs559464900 C T 5118742

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results