Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 13683777 13699055 enh20355

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 13691175 rs552291637 GCATGCACCACCACGCCCAACTGAT G 6564018
chr3 13691189 rs573471857 G A 6564019

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results