Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80774945 80783195 enh92761

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80779223 rs146460844 T TTAAAGCTGTTGATTTAAAGTC 5124979

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results