Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 129060132 129067823 enh20927

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 129061260 rs568797781 CCTGACCTCAGGTGATTCGCCCGCCT C 7025329

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results