Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 131055885 131060335 enh35873
chr3 131056791 131057139 vista42442

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 131056849 rs369264237 TGATCTCAGGTCACTGCAGTGGCAC T 7033395
chr3 131056850 rs9840214 G A 7033396

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results