Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 132340585 132344815 enh61085

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 132340614 rs146674107 CTACCTGTCTTTACCAAATGA C 7038946
chr3 132340615 rs201069358 T A,C 7038947

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results