EnhancerDB
  1. Home
  2. TFBS
  3. RFX5[chr3:133141597-133141612]
Chromosome characteristics of RFX5[chr3:133141597-133141612]
Back to top
Enhancers possibly regulated by RFX5[chr3:133141597-133141612]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 133140485 133149635 enh7548
Bone (Osteoblast) Peripheral Blood (MM.1S) Blood (Karpas-422) Spleen Muscle (Myotube) Epithelial (MCF-7)
SNP sites on RFX5[chr3:133141597-133141612]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 133141598 rs184033402 C T 7041435
chr3 133141609 rs201864137 C CTGCCAGAATATAGCCCAGGTGT 7041436
chr3 133141609 rs758347029 C CTGCCAGAATATAGCCCAGGTGT 7041437
chr3 133141609 rs766454660 C CTGCCAGAATATAGCCCAGGTGT 7041438
Genes possibly regulated by RFX5[chr3:133141597-133141612]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX5[chr3:133141597-133141612]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results