Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 133140485 133149635 enh7548

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 133141609 rs201864137 C CTGCCAGAATATAGCCCAGGTGT 7041436
chr3 133141609 rs758347029 C CTGCCAGAATATAGCCCAGGTGT 7041437
chr3 133141609 rs766454660 C CTGCCAGAATATAGCCCAGGTGT 7041438

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results