Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 133514365 133521295 enh63202

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 133520807 rs527304421 AGCATACGGTTAAGTAGATAGAAGCCCAATT A 7043664
chr3 133520813 rs151060476 C T 7043665

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results