Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 133809085 133816055 enh20952

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 133810150 rs143745725 CTGGTATACCTTTGTATACT C 7045115
chr3 133810150 rs79130360 CTGGTATACCTTTGTATACT C 7045116

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results