Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 110647505 110656495 enh30700

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 110650980 rs552494210 ACTTCCTCTTAATGCAAAAC A 3389621

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results