Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 111135945 111140695 enh92499

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 111138411 rs193120299 T G 3395100
chr13 111138417 rs556055578 G GTGAAGCATGTTGTCTGCATTTT 3395101

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results