Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 112034305 112043855 enh47717
chr13 112038408 112038767 vista17100

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 112038556 rs147567978 G GTATATATATATAGTGTGTA,GTGTA 3401493

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results