Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113096385 113100535 enh88079

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113099602 rs567270084 G A,T 3404002
chr13 113099611 rs138532828 AGGAGACTGAGGTGAACAGAGCAGGATGGGGGTGC A 3404003
chr13 113099611 rs60816959 AGGAGACTGAGGTGAACAGAGCAGGATGGGGGTGC A 3404004

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results