Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113258405 113263101 enh91021

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113259651 rs548365287 T TAATAATAATAATAATAATAAC 3404692

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results