Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113310342 113315346 enh30707

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113314057 rs576261344 T TTCACATGGAGATGATTAGCG 3405003

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results