| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr13 | 113356925 | 113401095 | enh15512 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr13 | 113385617 | rs138150792 | GTTAGCTTTATTACTAAAGAAAACAGA | G | 3405957 | |
| chr13 | 113385617 | rs796957258 | GTTAGCTTTATTACTAAAGAAAACAGA | G | 3405958 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|