Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 115026345 115036395 enh3029

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 115033242 rs568845005 G GAGAGGAAGGGTCCAGATTGGTATATTTTTAA 3416928

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results